Mother-to-Child Transfer of Reactivated Varicella-ZosterVirus DNA and Varicella-Zoster IgG in Pregnancy
Viral Immunol. 2019 Dec 13. doi: 10.1089/vim.2019.0090. [Epub ahead of print] PMID: 31834852 doi.org/10.1089/vim.2019.0090
Mother-to-Child Transfer of Reactivated Varicella-ZosterVirus DNA and Varicella-Zoster IgG in PregnancyVivek Ranjan,1Alaknanda Mishra,2Ashwani Kesarwani,2K. Varsha Mohan,2Sandeep Narayan Lal,1Jacob Puliyel,1and Pramod Upadhyay2 1Department of Pediatrics, St. Stephens Hospital, New Delhi, India.2National Institute of Immunology, New Delhi, India.VIRAL IMMUNOLOGYVolume 00, Number 00, 2019ªMary Ann Liebert, Inc.Pp. 1–5DOI: 10.1089/vim.2019.009 AbstractStress-induced subclinical reactivation of varicella-zoster virus (VZV) has been studied previously. However,subclinical reactivation of VZV induced by the stress of pregnancy has not been investigated. The objective wasto study varicella DNA and varicella antibody levels in mothers and their newborn babies. VZV immuno-globulin G (IgG) levels in 350 mother–newborn dyads were studied using indirect enzyme-linked immuno-sorbent assay testing. A subset of 73 dyads was selected, DNA was isolated from the serum samples, andquantitative polymerase chain reaction (qPCR) was performed. Nearly 15% (14.6%) mothers tested werepositive for varicella antibodies (>100 mIU/dL) and 16% were borderline (<100 and>50 mIU/dL). Approxi-mately 16.9% of the babies were positive, and 18% were in borderline. Among those tested for VZV-DNA,70% of mothers with low VZ-IgG (<100 mIU/dL) and 11.32% of those with high VZ-IgG (>100 mIU/dL) werepositive for DNA. Among the newborns, 60% of those with low VZ-IgG and 15% of those with high VZ-IgGwere positive for DNA. Mothers who have had VZV infection in the past can transmit VZV DNA to theirbabies.Keywords:varicella-zoster virus, varicella-zoster DNA, varicella-zoster IgG, pregnancy, mother-to-childtransferIntroductionThe human viromeis a part of the microbiome and it ismade up of virus found in or on the human body, in theabsence of symptoms of infection (16). Moustafaet al.ana-lyzed the blood DNA virome in 8,000 humans and identifiedgenetic material of 19 viruses among 42% of the asymp-tomatic individuals they studied. Many members of theHerpesviridae were identified but not the varicella-zostervirus (VZV) (13).VZV remains latent after primary infection but it is knownto reactivate when there is a decline in the cell-mediatedimmunity. VZV may be reactivated after surgical stress andMehtaet al.have demonstrated that the stress of space travelin astronauts can induce subclinical reactivation of VZV (11).The reactivated VZV may lead to typical symptoms of VZVinfection or it could be subclinical and VZV has been detectedin saliva of a few patients (6,12).Reactivation of VZV induced by the stress of pregnancyhas not been investigated previously. We look for VZVDNA and VZV antibodies in antenatal maternal blood andin their newborn babies.Materials and MethodsEthical approvalEthical approval was obtained from the St. Stephens Hos-pital Ethical Committee, Delhi (dated July 1, 2016) and theInstitutional Human Ethics Committee of the National In-stitute of Immunology, New Delhi (IHEC#99/17).This was a prospective study conducted at a tertiary carehospital in Delhi, India, between June 2016 and June 2017.The study was performed jointly by the St. Stephens Hospital,Delhi and the National Institute of Immunology, New Delhi.Sample size estimation was based on the results of Linderet al., who observed that 24% of 2-month-old babies carriedmaternal anti-VZV antibodies (9). The sample size requiredfor detection of a prevalence of 24% with a precision of 5%(a=0.05) was 281.Mothers who delivered at St. Stephens Hospital wereeligible for inclusion in the study except for those who re-ceived blood transfusion during pregnancy or were vacci-nated against VZV. Consent of mothers for participation inthe study and for collection of cord blood was obtained beforedelivery. The mother’s sample was collected during routine. tenatal blood checkups. Cord blood of the neonate wascollected at delivery. To ensure we had suitable samples from300 dyads, consent was obtained from 600 mothers assuming25% of the samples from mother and babies may not besuitable for testing. We anticipated that, even pessimistically,we could expect 50% of the cases would line up as dyads.Two milliliters blood from mother and 2 mL cord bloodwere collected in dry tubes and centrifuged for 15 min at3,000g. The serum was extracted and stored at-20°Cbeforebeing sent to National Institute of Immunology, New Delhifor DNA testing and estimation of antibody titers.VZV antibodiesThe serum antibody to VZV was estimated by indirectenzyme-linked immunosorbent assay (ELISA) method. Theserology results are stated as mean titers with standard errorof mean.Preparation of standardsFor the standard preparation we quantified the concentra-tion of the VZV positive serum from commercially availablekit (varicella-zoster virus IgG, Serion ELISA classic; Wu ̈rz-burg, Germany) along with in-house serum sample. Quanti-fication of standard (from kit) verses in-house serum wasperformed as described hereunder and the calculation wascarried out as suggested in the kit.‘‘In house’’ VZV indirect ELISAVaricella immunoglobulin G (IgG) antibody titer wasassessed by an ‘‘in-house’’ indirect ELISA. Coster assay 96-well microtiter plates were coated with varicella vaccinelive, 1,350 PFU/0.5 mL (VaripedÒ; Merck Sharp & DohmeB.V., Haarlem, the Netherlands) diluted at 1:100 in 0.01 Mphosphate-buffered saline (PBS), pH 7.2, and incubatedovernight at 4°C.Coated plates were washed with 0.01 M PBS Tween-20(PBST), pH 7.2 once for 2 min. Tenfold dilution of themother and cord serum samples were prepared in 0.01 MPBS, pH 7.2, and 1% bovine serum albumin; similarly,1:100 dilution of in-house serum and ready-to-use VZVstandard serum (from kit) was added to the plate and incu-bated for 60 min at 37°C in moist chamber. In the next step,goat anti-human IgG horseradish peroxidase (GeNei La-boratories, Bangalore) diluted 1:200 in 0.01 M PBS, pH 7.2was added, and incubated for 60 min at 37°C. Furthermore,100lLof3,3¢,5,5¢-tetramethylbenzidine (BD) substrate wasadded to each well. As soon as color started to develop, 50lLof 2 M H2SO4was added to stop the reaction. OD was read at450 nm in ELISA reader, using 630 nm as a reference filter(Bio-Tek Instruments). In between the steps, wells werewashed three times for 2 min each with 0.01 M PBS, pH 7.2,and 0.05% Tween 20. Varicella-zoster antibodies were ex-pressed in IU/mL using the curve comparison method toconvert optical density in concentration units.According to the product’s manual, IgG titers againstVZV>100 mIU/dL is positive, between 50 and 100 mIU/dLis borderline, and<50 mIU/dL is negative.Varicella-zoster DNADNA isolation from patient’s serum.DNA was isolatedfrom the serum samples using MasterPure complete DNAand RNA Purification Kit (Epicentre) according to themanufacturer’s instructions. In brief, 150lLof2·tissueand cell lysis solution containing 3lL proteinase K (pro-vided with the kit) was mixed with 150lL serum sample.The sample was incubated at 65°C for 15 min. The samplewas cooled and 1lLof5lg/mL RNase A was added andincubated at 37°C for 30 min. Protein was precipitated byadding MPC protein precipitation reagent to the sample inice and spun to collect the aqueous supernatant. DNA wasprecipitated by adding isopropanol followed by washingwith 70% ethanol. DNA was quantified by nanodrop spec-trophotometer (Thermo Fisher).Polymerase chain reaction.DNA was isolated usingEpicentre kit. DNA was quantified and 150 ng of total DNAwas used for the PCR. Primer and TaqMan probe for VZVDNA polymerase gene (Gene bank accession no. X04370)were referred (21) and its specificity was confirmed byprimer blast search tool. Melting temperature (Tm) wasbetween 55°Cand60°C and the amplicon length was 63 bp.TaqMan probe sequence (26 nucleotide) was customizedwith Fluorescein amidites (FAM) at 5¢end and Tetra-methylrhodamine (TAMRA) at 3¢end.qPCR was performed in a total reaction volume of 20lLusing TakyonÔROX probe MasterMixdTTP Blue fromEurogentec (Seraing, Belgium) according to the recom-mendations of the manufacturer. Final concentration of50 nM for the primers and 250 nM for the probes was used.The amplification conditions consisted of one-time TakyonÔactivation for 3 min at 95°C followed by 40 cycles of dena-turation at 95°C for 10 s and annealing/extension at 58.9°C for60 s. Because of scarcity of sample volume, randomly selected30% samples were repeated for DNA extraction followed byPCR amplification was repeated in 30% of the samples toreconfirm the findings.Table1.Sequence of Varicella-Zoster Virus Primers, TaqMan Probe, and150Nucleotide Long SequenceVZV forward5¢CGGCATGGCCCGTCTAT3¢VZV reverse5¢TCGCGTGCTGCGGC3¢TaqMan probeFAM 5¢ATTCAGCAATGGAAACACACGACGCC3¢TAMRA150 nucleotides longsequence5¢ATCTGGCGATGTGCATCTGCAATTATGCGTCCAAACCCGGCCATCCCAGACGGCATGGCCCGTCTATTCCATTCAGCAATGGAAACACACGACGCCTCCGCCGCAGCACGCGAGACGGTGTCGTCATATAACAACAGTTCTACAAGTTTG3¢Nucleotide strings of forward primer sequence are given in bold followed by TaqMan probe sequence in bold and italics, and reverseprimer sequence in italic for VZV.VZV, Varicella-zoster virus.
The quantitative standard template.A synthesized 150nucleotide sequence (Sigma) as given in Table 1 was used asan internal control. It has 50 and 37 bases upstream of for-ward primer and downstream of reverse primer, respectively.TaqMan probe designed for VZV detection was checked forcross-reactivity with other herpes viruses using NCBI primerblast software tool. The herpes viruses, human herpes type I,Homo sapiens, and viruses nonredundant databases were usedto search any nonspecific target. No such nonspecific tem-plate was found indicating the TaqMan probe to be specific.Same probe and primers were used for the target sequenceand the internal control.Standard curve.Quantitative estimation of viral DNAwas carried out by drawing the standard curve using knownamount of 150 nucleotide VZV sequence. Serial dilutionwas prepared containing 109to 101copies per reaction.Enumeration of VZV DNA in mother and child serum wascarried out by plotting cycle threshold (Ct) values againstthe standard curve.ResultsIn this study, consent was taken from 600 mothers forparticipation in the study. Blood samples from 403 mothersand 547 cord blood samples were found acceptable fortesting. The mean birth weight of the 547 babies studied was2.86 kg. There were no preterm babies and very few had lowbirth weight. A total of 350 maternal blood samples werepaired with respective cord blood sample of their babies assummarized in Venn diagram in Figure 1. For VZV DNAestimation, from 350 paired samples—73 mothers and theirbabies were selected across three VZV antibody categories,high (>100 mIU/dL), borderline (50–100 mIU/dL), and lowlevels (<50 mIU/dL). The median age of mothers in ourstudy was 27 years and the median weight of babies was2.9 kg. Among 547 babies, the sex ratio was 1,030 femalesper 1,000 males. A total of 403 mothers (91.6%) werepregnant for the first time.VZV antibodies titers.The mean IgG titer for anti-VZVin 403 mothers was 61.87–166.4 mIU/dL, whereas in 547babies the mean value of IgG titers for anti-VZV was59.9–127.6 mIU/dL. Among 350 mother–baby dyads, themean VZV IgG antibody titers in mothers was 67.3–177.61mIU/dL and babies was 65.02–144.4 mIU/dL.Thirteen percent of the 403 mothers, and 15% of 547babies had antibody titers>100 mIU/dL IgG. A total of 177(50.57%) babies had higher IgG VZV antibodies titers thantheir mother and 41 babies (11.7%) had titers>50 mIU/dLthan their mother’s titers. In 350 mother–baby dyads, theIgG titers were correlated, with a correlation coefficient of0.672 andp<0.0001.Among the 350 mother–baby dyads, 15% (14.6%)mothers tested were positive for varicella antibodies (>100mIU/dL) and 16% were borderline positive (<100 mIU/dLand>50 mIU/dL). About 16.9% of the babies were positive,and 18% were borderline positive. IgG titers in the dyadswere correlated, with a correlation coefficient of 0.672 andp<0.0001.We studied the maternal age and newborn weight againstthe neonatal VZV antibodies titers utilizing the receiveroperating curve characteristics. The area under the curvewas 0.53 and 0.52, respectively. Newborn antibody titerswere unrelated to these factors.Varicella-zoster virus DNA.We used TaqMan probe-mediated qPCR analysis to detect viral DNA transcytosedacross placenta. DNA extraction was performed in samplesobtained from 73 mothers and their babies. Of the 73mothers tested for VZV DNA, 53 had VZV IgG antibodylevels>100 mIU/dL and 20 had<100 mIU/dL. Six of the 53(11.32%) with VZV antibody>100 IU/dL tested positive forDNA, whereas 14 of 20 (70%) with VZV antibody<100IU/dL tested positive for DNA.In the same way 8 of 53 (15%) newborns with VZVantibody>100 IU/dL tested positive for DNA, whereas 12of 20 (60%) with VZV antibody<100 IU/dL tested positivefor DNA.When VZ-IgG was high, the viral load was less in ma-ternal system (23–1,156 copies/lL) and fetal system (76–437 copies/lL). However, when neutralizing IgG was low(IgG<100 mIU/dL) and the viral load was higher in ma-ternal system (113–1,406·102copies/lL), thus more VZVDNA was transcytosed to the fetus (18–1,075 copies/lL).These findings are summarized in Table 2.DiscussionVaccination against chickenpox is not common in India.Chickenpox is mild disease in children and it usually resultsin protection against VZV infection for life (2). This diseaseis highly contagious with attack rate of>85% after exposureFIG. 1.Summary of samples investigated in the study.Table2.Relationship Between VZ-IgG Levelsand DNA in Mothers and BabiesVZ-IgG>100mIU/dLVZ-IgG<100mIU/dLMother DNA11.3% (n=6/53),23–1,156 copies/lL70% (n=14/20),113–1,406·102copies/lLBaby DNA15.0% (n=8/53),76–437 copies/lL60% (n=12/20),18–1,075copies/lL
(17). Most people are immune by the age of 15 years becauseof natural infection. Wharton found that only 6% of adoles-cents 11–19 years were susceptible to VZV infection (22).Primary varicella infection acquired in adulthood is as-sociated with increased morbidity (7) and mortality (15)compared with infection acquired<14 years of age (5). Thereasons for this difference in morbidity with age are notclearly understood. Baba and colleagues have found that thedisease is milder in babies born to mothers who have ahistory of varicella infection. They have suggested this maybe because of the partial protection afforded by antibodies toVZV, passively transferred to the newborn (1). Howeverstudies on the decay of passively acquired antibodies sug-gest that such protection is unlikely to last beyond infancy(14,20).We did the study to observe potential vertical transfer ofVZV viral DNA and to examine antibody titer in mothersand their babies at birth. We examined VZV DNA and VZVantibody levels only in serum as some variability has beenreported regarding VZV DNA in saliva (6,12).Ours is arguably the largest such study in India looking atvaricella DNA and antibody in mother and baby dyads.Thirteen percent of tested mothers were positive for VZVantibodies, whereas 15% babies were positive. The maternalantibody levels were correlated to the neonatal antibodytiters with a correlation coefficient of 0.672 (p<0.0001).Our study supports the work of Leuridanet al.who dem-onstrated that the antibodies for infection like varicella andrubella in neonates at birth correlates strongly with thematernal values (8). There was no relation between maternalage and VZV antibody titers. Doroudchiet al.have alsoshown that maternal age and parity do not influence trans-placental antibody transfer (3).Although there was a correlation between maternal andfetal antibody levels, 21.7% babies had higher titers thantheir mothers (>25 mIU/dL), and 11.7% had titers>50mIU/dL than their mothers. It suggests that there may beactive transplancental transport of IgG from mother to thebaby. This is supported by the work of Techasenaet al.andWutzleret al.(18,24). They found that placenta activelytransports IgG to the baby. van den Berget al.found thatpreterm babies had lower antibody titers with respect to termbabies (19).It is known that hFcRn mediates transcytosis of IgGacross synctiotrophoblast. This mechanism plays a centralrole in protecting the fetus by passive immunization. In fetaldisease for congenital VZV, the treatment of pregnant wo-men with hyperimmune antiviral antibodies is known tosuppress infection in the mother and limit fetal disease forcongenital VZV (4), suggesting that hFcRn mediatestranscytosis of VZV IgG across synctiotrophoblast.Upon analyzing 73 dyads for VZV viral DNA usingTaqMan probe qPCR study, 19% were positive for viralantigen. This is similar to the finding of Mehtaet al.whofound subclinical reactivation of VZV with stress (11). Wefound more copies of viral DNA in mothers with lower IgGtiters (IgG<100 mIU/dL) and there was more likelihood oftransmission of DNA to their babies. This indicates that theprotective ability of the antibody is concentration depen-dent. Higher (>100 mIU/dL) neutralizing antibody rendershigher viral clearance in mother and less transfer to the fetusas seen by lower viral load in such dyads. Given the activetransplacental transfer machinery, more often higher viralload was seen in fetal system than maternal system. Ourfinding suggests a vertical transfer of VZV DNA. Moreover,qPCR analysis also shows the presence of viral DNA innewborns. This could be since the viral DNA can transcy-tose across the placental barrier and mediate a verticaltransfer from mother to offspring.Studies suggest hFcRn can cause transfer of viral DNA bythe receptor-mediated endocytosis (10,23). One possibilityis that the VZV DNA vertical transfer can potentially bemediated by this mechanism. Our findings suggest that whenmaternal and fetal IgG level is higher (>100 mIU/dL) theviral titer was less in mothers (23–1,156 copies/lL) andlower in fetal system (76–437 copies/lL). However, whenneutralizing IgG antibodies were low (IgG<100 mIU/dL) theviral load was higher in maternal system (113–1,406·102copies/lL), and more VZV DNA was transcytosed to thefetus (18–1,075 copies/lL). In such cases, the fetus receiveslower IgG but higher VZV viral DNA.It is likely that in such cases antibodies were developedactively in the fetus when viral DNA is high. It should beemphasized that the samples included in the study wereasymptomatic of VZV infection and that we have not ex-amined the infectivity and replication of the viral DNA inhost system. Thus, the exact nature of antibody–viral DNAinteraction in circulation needs to be elucidated. However,actively acquired antibodies are likely to last longer. It mayexplain why varicella infection is a mild infection at<14years of age (5), well after the stage where passively ac-quired antibodies from the mother would have waned. Morestudies are needed to confirm our findings.Authors’ ContributionsJ.P., V.R., P.U. conceived the project; V.R., S.N.L.; A.M.,A.K., K.V.M. conducted the study, and writing the first draft;A.M., A.K., K.V.M., and P.U. did the testing. The final draftwas by K.V.M., A.K., J.P., and P.U. All the authors have seenthe final article and approved it. J.P. and P.U. stand asguarantors for the work and corresponding authors.Author Disclosure StatementNo competing financial interests exist.Funding InformationThis study was supported by the core grant received fromthe Department of Biotechnology, Government of India toNational Institute of Immunology, New Delhi. Funders haveno role in study design, collection, analysis, and interpre-tation of data.References1. Baba K, Yabuuchi H, Takahashi M,et al.Immunologic andepidemiologic aspects of varicella infection acquired duringinfancy and early childhood. J Pediatr 1982;100:881–885.2. Chaves SS, Lopez AS, Watson TL,et al.Varicella in in-fants after implementation of the US varicella vaccinationprogram. Pediatrics 2011;128:1071–1077.3. Doroudchi M, Samsami Dehaghani A, Emad K,et al.Placental transfer of rubella-specific IgG in fullterm andpreterm newborns. Int J Gynaecol Obstet 2003;81:157–162.4RANJAN ET AL.Downloaded by Gothenburg University Library from www.liebertpub.com at 12/16/19. For personal use only.
4. Enders G. Management of varicella-zoster contact and in-fection in pregnancy using a standardized varicella-zosterELISA test. Postgrad Med J 1985;61 Suppl 4:23–30.5. Fairley CK, and Miller E. Varicella-zoster virus epidemi-ology—a changing scene? J Infect Dis 1996;174 Suppl 3:S314–S319.6. Gershon AA. The history and mystery of VZV in saliva.J Infect Dis 2011;204:815–816.7. Guess HA, Broughton DD, Melton LJ, 3rd.,et al.Population-based studies of varicella complications. Pe-diatrics 1986;78:723–727.8. Leuridan E, Hens N, Hutse V,et al.Kinetics of maternalantibodies against rubella and varicella in infants. Vaccine2011;29:2222–2226.9. Linder N, Waintraub I, Smetana Z,et al.Placental transferand decay of varicella-zoster virus antibodies in preterminfants. J Pediatr 2000;137:85–89.10. Maidji E, McDonagh S, Genbacev O,et al.Maternal an-tibodies enhance or prevent cytomegalovirus infection inthe placenta by neonatal Fc receptor-mediated transcytosis.Am J Pathol 2006;168:1210–1226.11. Mehta SK, Cohrs RJ, Forghani B,et al.Stress-inducedsubclinical reactivation of varicella zoster virus in astro-nauts. J Med Virol 2004;72:174–179.12. Mehta SK, Tyring SK, Gilden DH,et al.Varicella-zostervirus in the saliva of patients with herpes zoster. J InfectDis 2008;197:654–657.13. Moustafa A, Xie C, Kirkness E,et al.The blood DNAvirome in 8,000 humans. PLoS Pathog 2017;13:e1006292.14. Nicoara C, Zach K, Trachsel D,et al.Decay of passivelyacquired maternal antibodies against measles, mumps, andrubella viruses. Clin Diagn Lab Immunol 1999;6:868–871.15. Preblud SR. Age-specific risks of varicella complications.Pediatrics 1981;68:14–17.16. Rascovan N, Duraisamy R, and Desnues C. Metagenomicsand the human virome in asymptomatic individuals. AnnuRev Microbiol 2016;70:125–141.17. Singh MP, Chandran C, Sarwa A,et al.Outbreak ofchickenpox in a Union Territory of North India. Indian JMed Microbiol 2015;33:524–527.18. Techasena W, Sriprasert P, Pattamadilok S,et al.Measlesantibody in mothers and infants 0–2 years and response tomeasles vaccine at the age of 9 and 18 months. J MedAssoc Thai 2007;90:106–112.19. van den Berg JP, Westerbeek EA, van der Klis FR,et al.Transplacental transport of IgG antibodies to preterm infants:a review of the literature. Early Hum Dev 2011;87:67–72.20. Waaijenborg S, Hahne SJ, Mollema L,et al.Waning ofmaternal antibodies against measles, mumps, rubella, andvaricella in communities with contrasting vaccinationcoverage. J Infect Dis 2013;208:10–16.21. Weidmann M, Meyer-Konig U, and Hufert FT. Rapid de-tection of herpes simplex virus and varicella-zoster virusinfections by real-time PCR. J Clin Microbiol 2003;41:1565–1568.22. Wharton M. The epidemiology of varicella-zoster virusinfections. Infect Dis Clin North Am 1996;10:571–581.23. Wilcox CR, Holder B, and Jones CE. Factors affecting theFcRn-mediated transplacental transfer of antibodies andimplications for vaccination in pregnancy. Front Immunol2017;8:1294.24. Wutzler P, Schmidt-Ott R, Hoyer H,et al.Prevalence ofinfluenza A and B antibodies in pregnant women and theiroffspring. J Clin Virol 2009;46:161–164.Address correspondence to:Dr. Jacob PuliyelDepartment of PediatricsSt. Stephens HospitalDelhi 110055IndiaE-mail:puliyel@gmail.comDr. Pramod UpadhyayNational Institute of ImmunologyArunaAsaf Ali MargNew Delhi 110067IndiaE-mail:pkumar@nii.ac.inMOTHER-TO-CHILD TRANSFER OF VZV ANTIBODY AND DNA5Downloaded by Gothenburg University Library from www.liebertpub.com at 12/16/19. For personal use only.